Pocket Fighter Nova

Sponsored
Add to Favourites
  • Current rating 3.48/5
  • 1
  • 2
  • 3
  • 4
  • 5

Rates: 651 Pocket fighter nova

Played: 130348
Tags: Action EXE Fighting Flash Games Heroes Multiplayer

Description: Select your character and fight against another fighter at your keyboard or Artificial Intelligence. Fighting is really simplified for users - there are only three attack buttons. Use W A S D or Arrows to move, use J to punch, K to kick and L for special attack.

Similar:
Street Fighter 2 Champion Edition Dragon Ball Z Fight Karate Blazers Madness Accelerant
Madness Regent Fight 3 Madness: Project Nexus Madness Combat Defense
Street fighters Power Fox 4 Trolls Rage LRD Rebirth
Fighters Rampage Faith fighter Mortal Kombat Karnage GOON: The Game
Stick Dude Killing Arena Stick trinity The Swords

Comments

Comments

    
  • us Plogyneorne @ 2013-12-12 01:13:24

    Anna Sui is usually a true original. I love her design aesthetic in clothes plus makeup; one part glam, one part bohemian, one part whimsical using a pinch of Victorian. Sounds a little wacky but it works and works beautifully. In the interest with full disclosure I admit i always am a packaging whore. I LOVE pretty elements and Anna does also. Her ornate designs acceptance compacts, nail polishes and lipstick tubes similarly. Just take a have a look at this absolutely darling nail plate polish

    Like Reply
  • cn carpinteyrozor @ 2013-11-02 18:59:51

    Ten teams participating in a federal design competition have come up with 41 projects they say...- 11:41 am Toms River officials held a press conference in Ortley Beach Monday, the eve of the one-year...- 11:38 am A major storm with hurricane-force gusts lashed southern Britain, the Netherlands and parts of...- 11:26 am The Giants went from 0-6 to right in the middle of the NFC East race in six days.- 5:14 pm Kenny Rogers kept the mood light on the way into the Country Music Hall of Fame and M

    Like Reply
  • fr neorposucceks @ 2013-08-24 18:32:04

    By that time it was 200 and basically a lost cause for Springbrook. the RPS12 block I guide RNA; tRNAGlu(UUC), and Jonathan Joels, McmChaos3/ embryos died late in gestation,? huh? The brand new Birmingham Comic Con will run alongside the longestablished Memorabilia show at the NEC.Shauna leavitt piano fees Funny christmas desktop backgrounds Western themed christmas ideas Free prostate milking videos Wooden outdoor nativity pattern Create a lego character Pixie hallow promotion code Quick

    Like Reply
  • br eu sei joga @ 2013-03-12 01:09:31

    eu se souta o pow duvido quem saiba souta eu ganho pra todo mundo vai ve la nos potuasao eu to en primeiro!:)

    Like Reply
  • ru independant dubai escorts @ 2013-02-02 13:31:26

    Detta kommer att bli en fantastisk webbsida, kanske du är intresserad av att göra en intervju om hur du skapade den? Om så mejla mig!

    Like Reply
  • br lllllllllluuuuuuuuuucccccccccaaa @ 2012-06-15 20:27:32

    jogo maneiro derrotei todos os lutadores quem vem

    Like Reply
  • br wa @ 2012-04-06 23:30:43

    que cu

    Like Reply
  • fr tom cogne @ 2011-12-07 17:19:01

    super ce jeu !!!!!

    Like Reply
  • br mikale @ 2011-12-04 14:54:57

    bacana este jogo

    Like Reply
  • br bacana @ 2011-12-04 14:54:24

    mikael

    Like Reply
  • de Elliptical machine reviews @ 2011-11-28 07:34:21

    I suggest you to add a facebook like button!

    Like Reply
  • br matheus @ 2011-11-27 04:04:30

    éé mesmo gatas e

    Like Reply
  • no issa123 @ 2011-11-26 17:56:59

    bra

    Like Reply
  • br josue @ 2011-10-15 19:26:39

    vi toma do cú este jogo e uma merda

    Like Reply
  • br jojo @ 2011-10-13 21:45:11

    e da ora

    Like Reply
  • br RO @ 2011-10-09 13:36:47

    CHATO

    Like Reply
  • br ou gosa gosa porrra mela minha b @ 2011-09-16 18:05:09

    puta que paril essa porra ñ pega seus filho da puta porra porra puta que paril

    Like Reply
  • br lucas @ 2011-08-24 17:03:28

    legal muito legal

    Like Reply
  • br miquelly braz zdonek @ 2011-08-17 22:11:08

    adorei

    Like Reply
  • br micaelle @ 2011-08-17 22:08:51

    e chato

    Like Reply
  • br emanuell do nascimento @ 2011-08-17 22:08:01

    o jogo e muito legal

    Like Reply
  • br miquelly @ 2011-08-17 22:06:11

    e legal

    Like Reply
  • br miquelly @ 2011-08-17 22:05:49

    e legal vale a pena esperar

    Like Reply
  • br kj @ 2011-08-05 23:43:13

    é bom

    Like Reply
  • mx Alan @ 2011-07-18 05:43:31

    como se sacan los otros personajes??

    Like Reply
  • br ediv. @ 2011-07-06 16:30:49

    adorei

    Like Reply
  • br luciano @ 2011-06-13 21:57:51

    e devagar de+++++

    Like Reply
  • br dodeira @ 2011-05-04 16:16:39

    nao vou jogar essa porra

    Like Reply
  • br loading... @ 2011-04-19 20:37:33

    Thèse dfinfo

    Like Reply
  • br pau duro @ 2011-03-28 17:58:02

    vc são uma porra esta merda ñ carrega porque ñ vai TOMAR NU CÚ DE TODOS VC FILHOS DA PUTA PORRA PORRA!

    Like Reply
  • br curuja @ 2011-01-18 01:18:01

    esse jogo é bom seu ratos e pombas

    Like Reply
  • br emanuel @ 2011-01-12 23:33:20

    é muito bom essi jogo vale a pena espera carregar nigem vence de min nessi jogo que incara

    Like Reply
  • br e muito legal mas e para bons jo @ 2011-01-12 20:40:26

    muito massa vale a pena espera carrega!

    Like Reply
  • br essi jogos jogo emuito bom que i @ 2011-01-11 18:38:23

    que emcara eu vensu de todo mundo a

    Like Reply
  • br essi jogos jogo emuito bom que i @ 2011-01-11 18:37:08

    csdgdfgs

    Like Reply
  • br Reerer @ 2010-11-19 23:30:01

    Aaaaaa ganhei todo mundoo vao todo gtomar no cuuuu seus caraios

    Like Reply
  • pe estan lindo @ 2010-11-08 20:51:05

    hola me llamo jhanela este juego me encanta

    Like Reply
  • br 2010_5gvfvg @ 2010-11-07 13:11:38

    muito legal

    Like Reply
  • br EvilDanteDemo @ 2010-11-06 14:42:29

    quero ver quem ganha!!!só vim!

    Like Reply
  • br EvilDanteDemo @ 2010-11-06 14:41:50

    quero ver quem ganha de min!!!

    Like Reply
  • br kelvin @ 2010-11-06 12:30:54

    e massa esse jogo

    Like Reply
  • br kelvin @ 2010-11-06 12:30:15

    esse jogo e maravilhoso e massa

    Like Reply
  • br pedro @ 2010-10-23 12:06:41

    DeeMooRaa MuuItOOoOoOoOOo

    Like Reply
  • br Vitoor @ 2010-10-21 22:47:30

    esperando ... -.-" 24h

    Like Reply
  • br Vitoor @ 2010-10-21 22:45:47

    demooooora muito !! que poha que raiva

    Like Reply
  • br Vitoor @ 2010-10-21 22:43:16

    Esse jogo é fera , joguei com meus amigos e ganhei todas *_*

    Like Reply
  • br dddddddddddaaaaaaaaaaaaaaaaaaooo @ 2010-10-16 22:12:05

    e daora de mais

    Like Reply
  • lt erikas @ 2010-09-20 04:15:46

    geras tikrai

    Like Reply
  • gt cristinabella @ 2010-09-11 03:03:38

    wow is cool

    Like Reply
  • gt cristinabella @ 2010-09-11 03:03:10

    wow I berry cool

    Like Reply
  • br gui e gu @ 2010-07-20 21:07:15

    consegui jogar

    Like Reply
  • br gui e gu @ 2010-07-20 21:03:31

    eu devo conseguir jogar

    Like Reply
  • br gui e gu @ 2010-07-20 21:01:57

    demora muit++++

    Like Reply
  • br gui e gu @ 2010-07-20 20:59:59

    não consegui jogar

    Like Reply
  • ua STARTEK @ 2010-06-05 18:24:04

    CLASS

    Like Reply

Comment on this game

Join for a free, or log in if you are already a member.
We support OpenID as well.



Unique - One of these shapes is not like the others. Find it as fast as you can. Click on the shape which is unique. Each level adds distractions and challenges designed to trick your eye and hide the unique shape. Use mouse for control. 50 levels in total. Unique
  • Current rating 2.49/5

Random Game « »

Sponsored